msc-alff

Determination of incompatibility group plasmids

Determination of incompatibility group plasmids and copy number of the bla NDM-1 gene in carbapenem-resistant Klebsiella pneumoniae strains recovered from different hospitals in Kerman, Iran

Introduction. New Delhi metallo-β-lactamase (NDM)-producing Klebsiella pneumoniae has become a serious global health concern.

Hypothesis/Gap Statement. Due to the high genetic diversity among NDM-positive K. pneumoniae, we need further surveillance and studies to better understand the relationships between them. In addition, the coexistence of several plasmid replicon types in NDM-positive K. pneumoniae may affect the copy number of bla NDM, the MIC level to antibiotics, as well as increasing the chance of horizontal gene transfer.

Aim. The aim of this study was to determine incompatible plasmid groups and copy numbers of bla NDM, and to investigate the genetic relationship of 37 NDM-positive K. pneumoniae in Kerman, Iran.

Methodology. The bla NDM-1 gene was detected and confirmed by PCR-sequencing. The plasmid replicon types were determined by PCR-based replicon typing (PBRT) and the copy number of bla NDM-1 was determined by quantitaive real time-PCR (qPCR). Random amplified polymorphic DNA (RAPD)-PCR typing was used to detect genetic relationships between the strains.

Results. In this study, 10 different replicon types, including Frep [n=25 (67.5 %)], FIIAs [n=11 (29.7 %)], FIA [n=5 (13.5 %)], FIB [n=3 (8.1 %)], I1-Iγ [n=2 (5.4 %)], L/M [n=7 (18.9 %)], A/C [n=7 (18.9 %)], Y [n=3 (8.1 %)], P [n=1 (2.7 %)] and FIC [n=1 (2.7 %)] were reported. The copy numbers of the bla NDM-1 gene varied from 30.00 to 5.0×106 and no statistically significant correlation was observed between a rise of the MIC to imipenem and the copy numbers of bla NDM-1 (P>0.05). According to RAPD typing results, 35 strains were divided into five clusters, while two strains were non-typeable.Conclusion. The spread of NDM-1-producing K. pneumoniae strains that carry several plasmid replicon types increases the chance of horizontal transfer of antibiotic resistance genes in hospital settings. In this study, 10 different replicon types were identified. We could not find any relationship between the increase of MIC levels to imipenem and the copy numbers of bla NDM-1. Therefore, due to the identification of different replicon types in this study, the type and genetic characteristics of bla NDM-1-carrying plasmids, and other factors such as antibiotic selective pressure, probably affect the copy number of bla NDM-1 and change the MIC level to imipenem.

msc-alff
msc-alff
pLenti-CTLA4 shRNA-2 Plasmid
PVTBAV05689-2 2 ug
EUR 356
pLenti-FOXM1 shRNA-2 Plasmid
PVTBAV08732-2 2 ug
EUR 356
pLenti-JUN shRNA-2 Plasmid
PVTBAV11741-2 2 ug
EUR 356
pLenti-LHX6 shRNA-2 Plasmid
PVTBAV12881-2 2 ug
EUR 356
pLenti-MAGEA3 shRNA-2 Plasmid
PVTBAV13661-2 2 ug
EUR 356
pLenti-RUNX3 shRNA-2 Plasmid
PVTBAV20583-2 2 ug
EUR 356
pLenti-Slc7a11 shRNA-2 Plasmid
PVTBAV21973-2 2 ug
EUR 356
pLenti-STAT3 shRNA-2 Plasmid
PVTBAV22921-2 2 ug
EUR 356
pLenti-XRCC5 shRNA-2 Plasmid
PVTBAV26238-2 2 ug
EUR 356
Recombinant HIV-2 Protease Protein, Untagged, E.coli-10ug
QP12271-10ug 10ug
EUR 201
Recombinant Human BMP-2 Protein, Untagged, E.coli-10ug
QP5363-10ug 10ug
EUR 237
Recombinant Porcine IL 2 Protein, Untagged, E.coli-10ug
QP10699-10ug 10ug
EUR 201
Recombinant Canine MCP 2 Protein, Untagged, E.coli-10ug
QP10782-10ug 10ug
EUR 201
Recombinant Human Glutaredoxin-2, GST, E.coli-10ug
QP8154-ec-10ug 10ug
EUR 200
Recombinant Human Arginase-2, GST, E.coli-10ug
QP5676-ec-10ug 10ug
EUR 200
Recombinant Influenza Parainfluenza Type-2 Protein, Untagged, E.coli-10ug
QP12960-10ug 10ug
EUR 155
Recombinant Human STC 2 Protein, Untagged, HEK 293-10ug
QP13613-10ug 10ug
EUR 201
Recombinant Human CXCL2/ MIP-2 Protein, Untagged, E.coli-10ug
QP1016-10ug 10ug
EUR 237
Recombinant Bovine FGF 2 Protein, Untagged, Native Protein-10ug
QP10599-10ug 10ug
EUR 355
Recombinant Mouse MCP-2/ CCL8 Protein, Untagged, E.coli-10ug
QP5471-10ug 10ug
EUR 237
Recombinant Human MMP-2 Protein, His, HEK 293-10ug
QP10790-10ug 10ug
EUR 201
Recombinant Human Twinfilin-2 Protein, GST, E.coli-10ug
QP7777-ec-10ug 10ug
EUR 200
Recombinant Human Prohibitin-2 Protein, GST, E.coli-10ug
QP8027-ec-10ug 10ug
EUR 200
Recombinant Human Talin-2 Protein, His, Yeast-10ug
QP8291-ye-10ug 10ug
EUR 236
Recombinant Human Semenogelin-2 Protein, His, Yeast-10ug
QP9386-ye-10ug 10ug
EUR 308
Recombinant Human Hyaluronidase-2 Protein, His, Yeast-10ug
QP9753-ye-10ug 10ug
EUR 236
Recombinant Human Ficolin-2 Protein, His, Yeast-10ug
QP9759-ye-10ug 10ug
EUR 236
Recombinant Zebrafish Metallothionein-2 Protein, His, Yeast-10ug
QP9826-ye-10ug 10ug
EUR 362
Recombinant Chicken Vitellogenin-2 Protein, His, E.coli-10ug
QP8859-ec-10ug 10ug
EUR 326
Recombinant Mouse Renin-2 Protein, His, E.coli-10ug
QP8886-ec-10ug 10ug
EUR 272
Recombinant Human Metallothionein-2 Protein, GST, E.coli-10ug
QP8894-ec-10ug 10ug
EUR 200
Recombinant Human Plastin-2 Protein, His, Yeast-10ug
QP6289-ye-10ug 10ug
EUR 236
Recombinant Human Galectin-2 Protein, GST, E.coli-10ug
QP6295-ec-10ug 10ug
EUR 200
Recombinant Human Metaxin-2 Protein, GST, E.coli-10ug
QP6393-ec-10ug 10ug
EUR 272
Recombinant E.coli Thioredoxin-2 Protein, His, Yeast-10ug
QP7012-ye-10ug 10ug
EUR 362
Recombinant Bovine FGF 2 Protein, Untagged, E.coli-10ug
QP10599-EC-10ug 10ug
EUR 155
Recombinant Mouse Thrombospondin-2 Protein, His, E.coli-10ug
QP6786-ec-10ug 10ug
EUR 272
Recombinant Mouse Thrombospondin-2 Protein, His, Yeast-10ug
QP6786-ye-10ug 10ug
EUR 272
Recombinant Mouse Arginase-2, His-SUMO, E.coli-10ug
QP5677-ec-10ug 10ug
EUR 272
Recombinant Mouse Bcl-2 Protein, His, E.coli-10ug
QP5710-ec-10ug 10ug
EUR 155
Recombinant Dengue Virus Dengue Envelope-2 Protein, Untagged, Insect-10ug
QP11626-10ug 10ug
EUR 201
Recombinant Human IGF-2/ IGF-II Protein, Untagged, E.coli-10ug
QP5264-10ug 10ug
EUR 136
Recombinant Human CCL24/ Eotaxin-2/ MPIF-2 Protein, His, E.coli-10ug
QP8522-ec-10ug 10ug
EUR 200
Recombinant Human Bcl 2 (minus BH4 domain) Protein, His, E.coli-10ug
QP11138-10ug 10ug
EUR 201
Recombinant Human 2-5A-dependent ribonuclease Protein, His-SUMO, E.coli-10ug
QP6997-10ug 10ug
EUR 155
pDONR223-CD73 Plasmid
PVTB00480-2 2 ug
EUR 356
Recombinant Human Clavesin-2 Protein, His-SUMO, E.coli-10ug
QP7684-ec-10ug 10ug
EUR 200
Recombinant Mouse 2-oxoglutarate dehydrogenase, His-SUMO, E.coli-10ug
QP7717-ec-10ug 10ug
EUR 272
Recombinant Human Sesquipedalian-2 Protein, His-SUMO, E.coli-10ug
QP7760-ec-10ug 10ug
EUR 200
Recombinant Human Complexin-2/ CPLX2 Protein, GST, E.coli-10ug
QP7773-ec-10ug 10ug
EUR 272
Recombinant Human Vasohibin-2 Protein, His-SUMO, E.coli-10ug
QP7784-ec-10ug 10ug
EUR 272
Recombinant Macaque CXCL10/ Crg-2 Protein, His, E.coli-10ug
QP7849-ec-10ug 10ug
EUR 326
Recombinant Human Thioredoxin-2/ TXN2 Protein, GST, E.coli-10ug
QP8009-ec-10ug 10ug
EUR 200
Recombinant Human Calponin-2 Protein, His-SUMO, E.coli-10ug
QP8036-ec-10ug 10ug
EUR 200
Recombinant Human Thioredoxin reductase 2, His-SUMO, E.coli-10ug
QP8200-ec-10ug 10ug
EUR 200
Recombinant Human Talin-2 Protein, His-SUMO, E.coli-10ug
QP8291-ec-10ug 10ug
EUR 200
Recombinant Human Retinal dehydrogenase 2 Protein, His, Yeast-10ug
QP8968-ye-10ug 10ug
EUR 308
Recombinant Mouse Elongation factor 2 Protein, His, Yeast-10ug
QP9112-ye-10ug 10ug
EUR 272
Recombinant Human MBL-2/ MBL Protein, His, Yeast-10ug
QP9268-ye-10ug 10ug
EUR 236
Recombinant Bovine Serpin A3-2 Protein, His, Yeast-10ug
QP9699-ye-10ug 10ug
EUR 362
Recombinant Human Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug
QP8512-ec-10ug 10ug
EUR 200
Recombinant Human TIMP2/ TIMP-2 Protein, GST, E.coli-10ug
QP8571-ec-10ug 10ug
EUR 200
Recombinant Mouse CXCL2/ MIP-2 Protein, His, E.coli-10ug
QP8651-ec-10ug 10ug
EUR 272
Recombinant Human Glutamate carboxypeptidase 2 Protein, His, E.coli-10ug
QP8726-ec-10ug 10ug
EUR 200
Recombinant E.coli GTP cyclohydrolase-2 Protein, His, E.coli-10ug
QP8879-ec-10ug 10ug
EUR 326
Recombinant Mouse Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug
QP8884-ec-10ug 10ug
EUR 272
Recombinant Mouse Desmoglein-2 Protein, His-SUMO, E.coli-10ug
QP5947-ec-10ug 10ug
EUR 326
Recombinant Human Elongation factor 2 Protein, His, E.coli-10ug
QP5962-ec-10ug 10ug
EUR 200
Recombinant Human Estrogen Receptor 2 Protein, His, Yeast-10ug
QP6000-ye-10ug 10ug
EUR 236
Recombinant Mouse Hyaluronan synthase 2 Protein, His, E.coli-10ug
QP6144-ec-10ug 10ug
EUR 272
Recombinant Mouse Hyaluronan synthase 2 Protein, His, Yeast-10ug
QP6144-ye-10ug 10ug
EUR 272
Recombinant Human IL2/ Interleukin-2 Protein, GST, E.coli-10ug
QP6216-ec-10ug 10ug
EUR 200
Recombinant Human IL2/ Interleukin-2 Protein, His, Yeast-10ug
QP6216-ye-10ug 10ug
EUR 236
Recombinant Rabbit IL2/ Interleukin-2 Protein, His, E.coli-10ug
QP6218-ec-10ug 10ug
EUR 326
Recombinant Human Integrin alpha-2 Protein, His, Yeast-10ug
QP6238-ye-10ug 10ug
EUR 236
Recombinant Human Plastin-2 Protein, His-SUMO, E.coli-10ug
QP6289-ec-10ug 10ug
EUR 200
Recombinant E.coli Thioredoxin-2 Protein, His-SUMO, E.coli-10ug
QP7012-ec-10ug 10ug
EUR 326
Recombinant Human Septin-2 Protein, His-SUMO, E.coli-10ug
QP7552-ec-10ug 10ug
EUR 272
Recombinant Human SerpinB2/ PAI-2 Protein, Untagged, E.coli-10ug
QP10161-ec-10ug 10ug
EUR 290
Recombinant Human TIMP2/ TIMP-2 Protein, Untagged, E.coli-10ug
QP10162-ec-10ug 10ug
EUR 290
Recombinant Human CCL8/ MCP-2 Protein, Untagged, E.coli-10ug
QP10231-ec-10ug 10ug
EUR 290
Recombinant Human IL2/ Interleukin-2 Protein, Untagged, E.coli-10ug
QP10309-ec-10ug 10ug
EUR 154
Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-10ug
QP10390-ec-10ug 10ug
EUR 154
Recombinant Human 2-oxoglutarate dehydrogenase, His-SUMO, E.coli-10ug
QP6447-ec-10ug 10ug
EUR 200
Recombinant Rat Neuroendocrine convertase 2 Protein, His, E.coli-10ug
QP6473-ec-10ug 10ug
EUR 326
Recombinant Rat SerpinB2/ PAI-2 Protein, His, Yeast-10ug
QP6669-ye-10ug 10ug
EUR 272
Recombinant Human Tryptase beta-2 Protein, His, E.coli-10ug
QP6832-ec-10ug 10ug
EUR 200
Recombinant Mouse Tryptase beta-2 Protein, GST, E.coli-10ug
QP6833-ec-10ug 10ug
EUR 272
Recombinant Human CCL8/ MCP-2 Protein, GST, E.coli-10ug
QP4994-ec-10ug 10ug
EUR 200
Recombinant Human CCL8/ MCP-2 Protein, His, Yeast-10ug
QP4994-ye-10ug 10ug
EUR 236
Recombinant Human BMP-2 Protein, Untagged, HEK 293-10ug
QP5363-HEK-10ug 10ug
EUR 218
Recombinant Human Caspase-2 Protein, His-SUMO, E.coli-10ug
QP5762-ec-10ug 10ug
EUR 200
KRTAP12-2 cloning plasmid
CSB-CL012606HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: ATGTGTCATACCAGCTGCTCCTCGGGCTGCCAGCCAGCCTGCTGCGCGCCCAGCCCCTGCCAGCCAGCCTGTTGTGTGCCCAGCTCCTGCCAGGCATCCTGCTGTGTGCCTGTGGGCTGCCAGTCCTCCGTGTGTGTGCCCGTGAGCTTCAAGCCAGCCGTGTGCCTGCCCGTGAG
  • Show more
Description: A cloning plasmid for the KRTAP12-2 gene.
KRTAP4-2 cloning plasmid
CSB-CL861178HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: ATGGTCAACTCCTGTTGTGGCTCTGTGTGCTCTGACCAGGGCTGTGGCCTAGAGAACTGCTGCCGTCCCAGCTGCTGCCAGACCACCTGCTGCAGGACCACCTGCTGCCGCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCGCAGTGCTGCCAGTCTGTGTGCTGCCAGCCCAC
  • Show more
Description: A cloning plasmid for the KRTAP4-2 gene.
KRTAP3-2 cloning plasmid
CSB-CL871617HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 297
  • Sequence: atggattgctgtgcctctcgcagctgcagtgtccccactgggcctgccaccaccatctgctcctccgacaaatcctgccgctgtggagtctgcctgcccagcacctgcccacacacagtttggttactggagcccatctgctgtgacaactgtcccccaccctgccacattcctca
  • Show more
Description: A cloning plasmid for the KRTAP3-2 gene.
KRTAP9-2 cloning plasmid
CSB-CL880139HU1-10ug 10ug
EUR 257
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: ATGACCCACTGTTGCTCCCCTTGCTGTCAGCCTACATGCTGCAGGACCACCTGCTGCAGGACCACCTGCTGGAAGCCCACCACTGTGACCACCTGCAGCAGCACATCCTGCTGCCAGCCCGCCTGCTGTGTGTCCAGCTGCTGCCAGCCTTGCTGCCGCCCAACTTCCTGTCAAAA
  • Show more
Description: A cloning plasmid for the KRTAP9-2 gene.
KRTAP9-2 cloning plasmid
CSB-CL880139HU2-10ug 10ug
EUR 257
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 525
  • Sequence: atgacccactgttgctccccttgctgtcagcctacctgctgcaggaccacctgctgcaggaccacctgctggaagcccaccactgtgaccacctgcagcagcacaccctgctgccagcccgcctgctgtgtgtccagctgctgccagccttgctgccgcccaacttgctgtcaaaa
  • Show more
Description: A cloning plasmid for the KRTAP9-2 gene.
Plasmid Midi Kit I
K1314-2
EUR 262
Plasmid Midi Kit II
K1315-2
EUR 262
Plasmid ezFilter Mega3 Kit
K1320-2
EUR 343
Plasmid ezFilter Mega6 Kit
K1321-2
EUR 370
Plasmid ezFilter Mega10 Kit
K1322-2
EUR 452
pCR4-TOPO-RNF135 Plasmid
PVTB01189-2 2 ug
EUR 356
pGEM-Ltf(Q25R) Plasmid
PVTB50084-2 2 ug
EUR 356
Recombinant Human FKBP6 Protein, His, -10ug
QP10610-10ug 10ug
EUR 201
Recombinant Human Protein delta homolog 2 Protein, GST, E.coli-10ug
QP7755-ec-10ug 10ug
EUR 200
Recombinant Human Protein delta homolog 2 Protein, His, Yeast-10ug
QP7755-ye-10ug 10ug
EUR 236
Recombinant Human CD112/ Nectin-2/ PVRL2 Protein, His, E.coli-10ug
QP7863-ec-10ug 10ug
EUR 200
Recombinant Human GMP reductase 2 Protein, His-SUMO, E.coli-10ug
QP8126-ec-10ug 10ug
EUR 200
Recombinant Human AGO2/ Argonaute 2/ EIF2C2 Protein, His, E.coli-10ug
QP8243-ec-10ug 10ug
EUR 200
Recombinant Human AGO2/ Argonaute 2/ EIF2C2 Protein, His, Yeast-10ug
QP8243-ye-10ug 10ug
EUR 236
Recombinant Human RuvB-like 2 Protein, His-SUMO, E.coli-10ug
QP8295-ec-10ug 10ug
EUR 272
Recombinant Human Glucosidase 2 subunit beta Protein, GST, E.coli-10ug
QP8431-ec-10ug 10ug
EUR 200
Recombinant Human Orexin receptor type 2 Protein, His, Yeast-10ug
QP9175-ye-10ug 10ug
EUR 308
Recombinant Human Neuropeptide FF receptor 2 Protein, His, Yeast-10ug
QP9310-ye-10ug 10ug
EUR 236
Recombinant Human Transmembrane protease serine 2 Protein, His, Yeast-10ug
QP9439-ye-10ug 10ug
EUR 272
Recombinant Mouse Protein delta homolog 2 Protein, His, Yeast-10ug
QP9838-ye-10ug 10ug
EUR 308
Recombinant Human IL12RB2/ IL12R-beta 2 Protein, His, Yeast-10ug
QP9881-ye-10ug 10ug
EUR 236
Recombinant Human Ribonucleoprotein PTB-binding 2 Protein, His, Yeast-10ug
QP9902-ye-10ug 10ug
EUR 236
Recombinant Human Growth/ differentiation factor 2 Protein, His, Yeast-10ug
QP9936-ye-10ug 10ug
EUR 236
Recombinant Human Exportin-2 Protein, His-SUMO, Invitro-E.coli-10ug
QP9974-iv-10ug 10ug
EUR 780
Recombinant Human IGF-2/ IGF-II Protein, GST, E.coli-10ug
QP8601-ec-10ug 10ug
EUR 200
Recombinant Human NAP-2/ PPBP/ CXCL7 Protein, GST, E.coli-10ug
QP8641-ec-10ug 10ug
EUR 200
Recombinant Human Laminin subunit beta-2 Protein, His, E.coli-10ug
QP8788-ec-10ug 10ug
EUR 200
Recombinant Rat BDNF Protein Isoform 2 Protein, His, E.coli-10ug
QP8869-ec-10ug 10ug
EUR 272
Recombinant Human CETN2/ Centrin 2 Protein, His-SUMO, E.coli-10ug
QP5820-ec-10ug 10ug
EUR 200
Recombinant Human CFL2/ cofilin 2/ ADF Protein, GST, E.coli-10ug
QP5825-ec-10ug 10ug
EUR 200
Recombinant Human Clathrin heavy chain 2 Protein, His, E.coli-10ug
QP5842-ec-10ug 10ug
EUR 200
Recombinant Human Clathrin heavy chain 2 Protein, His, Yeast-10ug
QP5842-ye-10ug 10ug
EUR 236
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug
QP5968-ec-10ug 10ug
EUR 200
Recombinant Human Glycerol kinase 2 Protein, His-SUMO, E.coli-10ug
QP6085-ec-10ug 10ug
EUR 200
Recombinant Macaque IL2/ Interleukin-2 Protein, His-SUMO, E.coli-10ug
QP6217-ec-10ug 10ug
EUR 326
Recombinant Human Integrin alpha-2 Protein, His-SUMO, E.coli-10ug
QP6238-ec-10ug 10ug
EUR 200
Recombinant Human JAM-2/ JAM-B Protein, His, E.coli-10ug
QP6247-ec-10ug 10ug
EUR 200
Recombinant Human JAM-2/ JAM-B Protein, His, Yeast-10ug
QP6247-ye-10ug 10ug
EUR 236
Recombinant Rat MMP-2/ CLG4A Protein Protein, His, Yeast-10ug
QP6369-ye-10ug 10ug
EUR 272
Recombinant Human Tumor suppressor candidate 2 Protein, GST, E.coli-10ug
QP6856-ec-10ug 10ug
EUR 200
Recombinant Mouse Hemoglobin subunit beta-2 Protein, GST, E.coli-10ug
QP7346-ec-10ug 10ug
EUR 272
Recombinant Mouse Hemoglobin subunit beta-2 Protein, His, Yeast-10ug
QP7346-ye-10ug 10ug
EUR 272
Recombinant Human NAP-2/ PPBP/ CXCL7 Protein, Untagged, E.coli-10ug
QP10212-ec-10ug 10ug
EUR 290
Recombinant Rat NAP-2/ PPBP/ CXCL7 Protein, Untagged, E.coli-10ug
QP10285-ec-10ug 10ug
EUR 290
Recombinant Human Nanos homolog 2 Protein, His-SUMO, E.coli-10ug
QP6402-ec-10ug 10ug
EUR 200
Recombinant Human Nuclear transport factor 2 Protein, GST, E.coli-10ug
QP6442-ec-10ug 10ug
EUR 200
Recombinant Human Phosphomannomutase 2/ PMM2/ CDG1 Protein, GST, E.coli-10ug
QP6508-ec-10ug 10ug
EUR 200
Recombinant Human PTGS2/ COX2/ PGHS-2 Protein, His, E.coli-10ug
QP6551-ec-10ug 10ug
EUR 200
Recombinant Rat SerpinB2/ PAI-2 Protein, His-SUMO, E.coli-10ug
QP6669-ec-10ug 10ug
EUR 272
Recombinant Human Serine palmitoyltransferase 2 Protein, His-SUMO, E.coli-10ug
QP6726-ec-10ug 10ug
EUR 200
Recombinant Human AK2/ Adenylate kinase 2 Protein, GST, E.coli-10ug
QP5635-ec-10ug 10ug
EUR 200
Recombinant Human CALCB/ CGPR/ Calcitonin 2 Protein, GST, E.coli-10ug
QP5747-ec-10ug 10ug
EUR 200
Recombinant Human Calpain-2 catalytic subunit Protein, His, E.coli-10ug
QP5756-ec-10ug 10ug
EUR 200
Recombinant Human Phosphatidylinositol Transfer Protein α Isoform/PITPNA (N-6His)
CE10-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 1mM EDTA, 1mM DTT, pH 8.0.
ToxOut? Endofree Plasmid Midi Kit
K1328-2
EUR 207
ToxOut? Endofree Plasmid Maxi Kit
K1330-2
EUR 234
ToxOut? Endofree Plasmid Mega3 Kit
K1332-2
EUR 316
ToxOut? Endofree Plasmid Mega6 Kit
K1333-2
EUR 370
ToxOut? Endofree Plasmid Mega10 Kit
K1334-2
EUR 425
pMD19-T-LEO1(E225G) Plasmid
PVTB01141-2 2 ug
EUR 356
Recombinant Human Actin-related protein 2/ 3 complex subunit 2 Protein, GST, E.coli-10ug
QP8442-ec-10ug 10ug
EUR 200
Recombinant Human Bcl-2-like protein 15 Protein, GST, E.coli-10ug
QP7698-ec-10ug 10ug
EUR 272
Recombinant Mouse Secretoglobin family 3A member 2 Protein, His, Yeast-10ug
QP7929-ye-10ug 10ug
EUR 308

Plasmids shape the diverse accessory resistomes of Escherichia coli ST131

The human gut microbiome includes beneficial, commensal and pathogenic bacteria that possess antimicrobial resistance (AMR) genes and exchange these predominantly through conjugative plasmids. Escherichia coli is a significant component of the gastrointestinal microbiome and is typically non-pathogenic in this niche. In contrast, extra-intestinal pathogenic E. coli (ExPEC) including ST131 may occupy other environments like the urinary tract or bloodstream where they express genes enabling AMR and host cell adhesion like type 1 fimbriae.

The extent to which commensal E. coli and uropathogenic ExPEC ST131 share AMR genes remains understudied at a genomic level, and we examined this here using a preterm infant resistome. We found that individual ST131 had small differences in AMR gene content relative to a larger shared resistome. Comparisons with a range of plasmids common in ST131 showed that AMR gene composition was driven by conjugation, recombination and mobile genetic elements.

Plasmid pEK499 had extended regions in most ST131 Clade C isolates, and it had evidence of a co-evolutionary signal based on protein-level interactions with chromosomal gene products, as did pEK204 that had a type IV fimbrial pil operon. ST131 possessed extensive diversity of selective type 1, type IV, P and F17-like fimbriae genes that was highest in subclade C2. The structure and composition of AMR genes, plasmids and fimbriae vary widely in ST131 Clade C and this may mediate pathogenicity and infection outcomes.

Development of a simplified and inexpensive RNA depletion method for plasmid DNA purification using size selection magnetic beads (SSMBs)

Plasmid DNA (pDNA) isolation from bacterial cells is one of the most common and critical steps in molecular cloning and biomedical research. Almost all pDNA purification involves disruption of bacteria, removal of membrane lipids, proteins and genomic DNA, purification of pDNA from bulk lysate, and concentration of pDNA for downstream applications. While many liquid-phase and solid-phase pDNA purification methods are used, the final pDNA preparations are usually contaminated with varied degrees of host RNA, which cannot be completely digested by RNase A.

To develop a simple, cost-effective, and yet effective method for RNA depletion, we investigated whether commercially available size selection magnetic beads (SSMBs), such as Mag-Bind® TotalPure NGS Kit (or Mag-Bind), can completely deplete bacterial RNA in pDNA preparations. In this proof-of-principle study, we demonstrated that, compared with RNase A digestion and two commercial plasmid affinity purification kits, the SSMB method was highly efficient in depleting contaminating RNA from pDNA minipreps.

Gene transfection and bacterial colony formation assays revealed that pDNA purified from SSMB method had superior quality and integrity to pDNA samples cleaned up by RNase A digestion and/or commercial plasmid purification kits. We further demonstrated that the SSMB method completely depleted contaminating RNA in large-scale pDNA samples. Furthermore, the Mag-bind-based SSMB method costs only 5-10% of most commercial plasmid purification kits on a per sample basis. Thus, the reported SSMB method can be a valuable and inexpensive tool for the removal of bacterial RNA for routine pDNA preparations.

Emergence of plasmid-mediated tigecycline resistance tet(X4) gene in Escherichia coli isolated from poultry, food and the environment in South Asia

The recent emergence of mobile-tigecycline resistance tet(X) genes in human and animals in China seriously threats the clinical utility of tigecycline. Here we focused on the isolation and molecular characterization of plasmid-mediated tigecycline resistance tet(X4)-positive E. coli from different sources in Pakistan using MinION and Illumina sequencing. The tet(X4) gene was detected in four E. coli isolates from poultry, chicken meat, wild bird and the slaughterhouse wastewater in Pakistan. Co-existence of colistin resistance mcr-1 gene was also detected in three isolates.

The four isolates belonged to different sequence types and the tet(X4) gene was located on plasmids ranging from 12,331 bp to 113,610 bp belonging to IncFII and IncQ replicon types with two genetic contexts ISCR2-tet(X4)-abh-ISCR2-lysR-floR-virD2 and ΔISCR2-abh-tet(X4)-ISCR2-virD2-floR, respectively. In all the four E. coli strains, tet(X4) was transferable by conjugation to E. coli J53 host strain. In addition, three of four strains transferred tet(X4) to a wild-type carbapenem resistant E. coli strain. To our knowledge, this is the first report of the emergence of plasmid-mediated tet(X4) gene from Pakistan. The convergence of tigecycline and colistin resistance in South Asia is a serious threat to human health.

Leave a Reply

Your email address will not be published. Required fields are marked *